⚡
Missense Point Mutation (Sickle Cell HbS: Glu6Val)
WILDTYPE (NORMAL)DNA Sequence:ATGGTGCACTCTACTCCTGAGGAGAAG
Protein Product:Met-Val-His-Ser-Thr-Pro-Glu-Glu-Lys
MUTANT (PATHOLOGICAL)Mutant DNA Sequence:ATGGTGCACTCTACTCCTGTGGAGAAG
Mutant Protein Product:Met-Val-His-Ser-Thr-Pro-Val-Glu-Lys
FUNCTIONAL & CLINICAL IMPACTMissense substitution (Glu6Val). Hydrophobic Valine patch causes HbS polymerization under hypoxia, sickling red blood cells.
Associated Condition: Sickle Cell Anemia STRUCTURAL ANATOMYKey Molecular Components
Single Nucleotide Polymorphism
A to T transversion at codon 6 of HBB exon 1.
Hydrophobic Valine Patch
Mutant Valine sticks to adjacent hydrophobic pocket in deoxy-HbS.
Given the 5' → 3' template DNA strand below, build the complementary 3' → 5' strand by selecting matching nucleotides (A-T, G-C).
Template Strand:ATGCGATCGATC
Select Nucleotide to Add: Q1: What is the primary biological function of Sickle Cell Point Mutation (HbS)?
Q2: Which cell location contains c.20A>T?